The error message indicates that there is a problem with the input file seq60787a941199.fasta and its contents are causing an issue when trying to compile the LaTeX document.
After examining the output, it appears that the problem lies in the length of the text file. The text file contains a long sequence of DNA data, which exceeds the maximum allowed line length for the paper size used in the document.
To fix this issue, you can try adding line breaks to the text file seq60787a941199.fasta to reduce its length and prevent it from exceeding the maximum allowed line length.
Here’s an example of how you can modify the text file:
>sequence
ATCGGCTAGCTGCTAGCTAGCTAGCTAGCTAGCTAGCTAGCTAGCTAGCTAGCTAGCT
>
>sequence2
ATCGGCTAGCTGCTAGCTAGCTAGCTAGCTAGCTAGCTAGCTAGCTAGCTAGCTAGCT
>
By breaking the long sequence into multiple lines, you can avoid exceeding the maximum allowed line length and prevent the compilation error.
Alternatively, if you cannot modify the original text file, you can try using a different paper size or font size in the LaTeX document to accommodate the longer text.
Last modified on 2023-05-21